Stem-loop sequence xtr-mir-302

AccessionMI0004878
DescriptionXenopus tropicalis miR-302 stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
   cc      cuuu        u      -   auguc 
5'   ccacua    aacauugg guacuu ucu     u
     ||||||    |||||||| |||||| |||     u
3'   ggugau    uuguaacc cgugaa ggg     u
   --      ---u        u      u   aaaaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172725.1: 1068787-1068855 [-]
antisense
ENSXETT00000051994 ; larp7-201; intron 8
Clustered miRNAs
< 10kb from xtr-mir-302
xtr-mir-302GL172725.1: 1068787-1068855 [-]
xtr-mir-367GL172725.1: 1068488-1068550 [-]

Mature sequence xtr-miR-302

Accession MIMAT0003636
Sequence

47 - 

uaagugcuccaauguuuuagugg

 - 69

Get sequence
Evidence by similarity; MI0000772
Predicted targets