Stem-loop sequence xtr-mir-365-1

AccessionMI0004879
DescriptionXenopus tropicalis miR-365-1 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   cc       a        ac           -----gau    uu 
5'   gcaggga aaugaggg  uuuugggggca        gugu  c
     ||||||| ||||||||  |||||||||||        ||||  a
3'   cguucuu uuauuccu  aaaauccccgu        caca  c
   -a       g        -a           aauaccau    uu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172788.1: 322881-322966 [+]
intergenic

Mature sequence xtr-miR-365

Accession MIMAT0003637
Sequence

55 - 

uaaugccccuaaaaauccuuau

 - 76

Get sequence
Evidence by similarity; MI0000767
Predicted targets