Stem-loop sequence xtr-mir-367

AccessionMI0004880
DescriptionXenopus tropicalis miR-367 stem-loop
Gene family MIPF0000162; mir-367
Stem-loop
             c   -      ac    u  ua 
5' uuacuguugc uau gugcaa  ucug gc  u
   |||||||||| ||| ||||||  |||| ||   
3' agugguaacg aug cacguu  agau ug  a
             -   u      -a    c  uu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172725.1: 1068488-1068550 [-]
antisense
ENSXETT00000051994 ; larp7-201; intron 8
Clustered miRNAs
< 10kb from xtr-mir-367
xtr-mir-302GL172725.1: 1068787-1068855 [-]
xtr-mir-367GL172725.1: 1068488-1068550 [-]

Mature sequence xtr-miR-367

Accession MIMAT0003638
Sequence

42 - 

aauugcacuguagcaaugguga

 - 63

Get sequence
Evidence by similarity; MI0000775
Predicted targets