Stem-loop sequence xtr-mir-383

AccessionMI0004881 (change log)
DescriptionXenopus tropicalis miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
      -c  a      aa    a        -      a 
5' cuc  uc gaucag  ggug uuguggcu uuuagu g
   |||  || ||||||  |||| |||||||| ||||||  
3' gag  ag cugguc  ucac gacaccga gaauua a
      aa  a      cg    -        c      u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 32341375-32341447 [-]
intergenic
Database links

Mature sequence xtr-miR-383

Accession MIMAT0003639
Sequence

7 - 

agaucagaaggugauuguggcu

 - 28

Get sequence
Evidence by similarity; MI0000800
Predicted targets