Stem-loop sequence xtr-mir-425

AccessionMI0004882
DescriptionXenopus tropicalis miR-425 stem-loop
Gene family MIPF0000242; mir-425
Stem-loop
   --  c     a         cac     u  a  - gaaa 
5'   gc uugga ugacacgau   ucccg ug gc c    c
     || ||||| |||||||||   ||||| || || |     
3'   cg aaccu gcugugcua   agggc ac cg g    u
   cu  a     c         -ua     u  -  c acac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172680.1: 1420290-1420366 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-425
xtr-mir-191GL172680.1: 1417075-1417160 [+]
xtr-mir-425GL172680.1: 1420290-1420366 [+]

Mature sequence xtr-miR-425-5p

Accession MIMAT0003640
Sequence

8 - 

aaugacacgaucacucccguuga

 - 30

Get sequence
Evidence by similarity; MI0001447
Predicted targets