Stem-loop sequence xtr-mir-455

AccessionMI0004883 (change log)
DescriptionXenopus tropicalis miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
   -u  c   c ug  g          u      a   c   gaa 
5'   cc ugg g  ag guaugugccc uggacu cau gug   g
     || ||| |  || |||||||||| |||||| ||| |||    
3'   gg acu c  uc cauauacggg accuga gua cac   c
   uu  a   c gu  a          u      c   c   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr8: 2703728-2703814 [+]
sense
ENSXETT00000047552 ; col27a1-201; intron 20
Database links

Mature sequence xtr-miR-455

Accession MIMAT0003641
Sequence

16 - 

uaugugcccuuggacuacaucg

 - 37

Get sequence
Evidence by similarity; MI0003513
Predicted targets