Stem-loop sequence xtr-mir-455

AccessionMI0004883
DescriptionXenopus tropicalis miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
   -u  c   c ug  g          u      a   c   gaa 
5'   cc ugg g  ag guaugugccc uggacu cau gug   g
     || ||| |  || |||||||||| |||||| ||| |||    
3'   gg acu c  uc cauauacggg accuga gua cac   c
   uu  a   c gu  a          u      c   c   gac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172790.1: 1789046-1789132 [-]
sense
ENSXETT00000047552 ; col27a1-201; intron 20

Mature sequence xtr-miR-455

Accession MIMAT0003641
Sequence

16 - 

uaugugcccuuggacuacaucg

 - 37

Get sequence
Evidence by similarity; MI0003513
Predicted targets