Stem-loop sequence xtr-mir-489

AccessionMI0004884 (change log)
DescriptionXenopus tropicalis miR-489 stem-loop
Gene family MIPF0000111; mir-489
Stem-loop
    ug ug c    ug             c       a       
5' g  g  g uuag  gucguauguauga gucauuu cuggau 
   |  |  | ||||  ||||||||||||| ||||||| ||||| u
3' c  c  c aauc  cggcauguauacu cagugag gauuuu 
    gu gu a    gu             a       -       
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr6: 24122612-24122695 [-]
intergenic
Database links

Mature sequence xtr-miR-489

Accession MIMAT0003642
Sequence

51 - 

agugacaucauauguacggcugc

 - 73

Get sequence
Evidence by similarity; MI0003124
Predicted targets