Stem-loop sequence xtr-mir-489

AccessionMI0004884
DescriptionXenopus tropicalis miR-489 stem-loop
Gene family MIPF0000111; mir-489
Stem-loop
    ug ug c    ug             c       a       
5' g  g  g uuag  gucguauguauga gucauuu cuggau 
   |  |  | ||||  ||||||||||||| ||||||| ||||| u
3' c  c  c aauc  cggcauguauacu cagugag gauuuu 
    gu gu a    gu             a       -       
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172740.1: 2377569-2377652 [-]
intergenic

Mature sequence xtr-miR-489

Accession MIMAT0003642
Sequence

51 - 

agugacaucauauguacggcugc

 - 73

Get sequence
Evidence by similarity; MI0003124
Predicted targets