Stem-loop sequence xtr-mir-499

AccessionMI0004885 (change log)
DescriptionXenopus tropicalis miR-499 stem-loop
Gene family MIPF0000173; mir-499
Stem-loop
   gu   a c        ua       c           guuaaa 
5'   gag g gaggcagu  agacuug agugauguuua      a
     ||| | ||||||||  ||||||| |||||||||||      u
3'   cuc c cuucguca  ucugaau ucacuacaagu      c
   --   c u        ug       u           acuuuu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr10: 34537722-34537808 [-]
intergenic
Database links

Mature sequence xtr-miR-499

Accession MIMAT0003643
Sequence

16 - 

uuaagacuugcagugauguuuag

 - 38

Get sequence
Evidence by similarity; MI0003183
Predicted targets