Stem-loop sequence xtr-mir-499

AccessionMI0004885
DescriptionXenopus tropicalis miR-499 stem-loop
Gene family MIPF0000173; mir-499
Stem-loop
   gu   a c        ua       c           guuaaa 
5'   gag g gaggcagu  agacuug agugauguuua      a
     ||| | ||||||||  ||||||| |||||||||||      u
3'   cuc c cuucguca  ucugaau ucacuacaagu      c
   --   c u        ug       u           acuuuu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172674.1: 3859186-3859272 [-]
intergenic

Mature sequence xtr-miR-499

Accession MIMAT0003643
Sequence

16 - 

uuaagacuugcagugauguuuag

 - 38

Get sequence
Evidence by similarity; MI0003183
Predicted targets