Stem-loop sequence xtr-let-7c

AccessionMI0004886 (change log)
DescriptionXenopus tropicalis let-7c stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   u   u  a      uu   g   u            uuagaa    a    
5'  gug gc uccagg  gag uag agguuguauggu      ugac ccc 
    ||| || ||||||  ||| ||| ||||||||||||      |||| || u
3'  cac cg agguuc  uuc auc uccaacauguca      auug ggg 
   u   u  -      cu   g   u            ------    a    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 23121720-23121813 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-let-7c
xtr-mir-99chr2: 23121034-23121104 [+]
xtr-let-7cchr2: 23121720-23121813 [+]
Database links

Mature sequence xtr-let-7c

Accession MIMAT0003644
Sequence

16 - 

ugagguaguagguuguaugguu

 - 37

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1