Stem-loop sequence xtr-let-7f

AccessionMI0004887 (change log)
DescriptionXenopus tropicalis let-7f stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   u      u   gu                ----------     gu 
5'  gcagga gag  aguagauuguauaguu          uuggg  c
    |||||| |||  ||||||||||||||||          |||||   
3'  cguccu uuc  ucauuugacauaucaa          agccc  a
   g      -   ug                uagagggucu     ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr8: 8410819-8410901 [-]
sense
ENSXETT00000061581 ; HUWE1-201; intron 65
Clustered miRNAs
< 10kb from xtr-let-7f
xtr-let-7fchr8: 8410819-8410901 [-]
xtr-mir-98chr8: 8410552-8410659 [-]
Database links

Mature sequence xtr-let-7f

Accession MIMAT0003645
Sequence

8 - 

ugagguaguagauuguauaguu

 - 29

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1