Stem-loop sequence xtr-let-7g

AccessionMI0004888 (change log)
DescriptionXenopus tropicalis let-7g stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --   u        u            uaagg    g     cca 
5'   ggc gagguagu guuuguacaguu     gucu ugaca   c
     ||| |||||||| ||||||||||||     |||| |||||    
3'   ccg uuccguca cggacaugucaa     uaga guugu   c
   au   -        c            -----    g     cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr4: 117752088-117752171 [+]
sense
ENSXETT00000006015 ; twf2-202; intron 3
Database links

Mature sequence xtr-let-7g

Accession MIMAT0003646
Sequence

4 - 

ugagguaguuguuuguacagu

 - 24

Get sequence
Evidence by similarity; MI0000137
Predicted targets