Stem-loop sequence xtr-let-7g

AccessionMI0004888
DescriptionXenopus tropicalis let-7g stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF0000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --   u        u            uaagg    g     cca 
5'   ggc gagguagu guuuguacaguu     gucu ugaca   c
     ||| |||||||| ||||||||||||     |||| |||||    
3'   ccg uuccguca cggacaugucaa     uaga guugu   c
   au   -        c            -----    g     cuc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172795.1: 329061-329144 [-]
sense
ENSXETT00000006015 ; twf2-202; intron 3

Mature sequence xtr-let-7g

Accession MIMAT0003646
Sequence

4 - 

ugagguaguuguuuguacagu

 - 24

Get sequence
Evidence by similarity; MI0000137
Predicted targets