Stem-loop sequence xtr-let-7i

AccessionMI0004889
DescriptionXenopus tropicalis let-7i stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF0000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        u                 u   --------  u     u u 
5' cuggc gagguaguaguuugugc guu        gg cgggu g g
   ||||| ||||||||||||||||| |||        || ||||| | a
3' gaucg uuccgucaucgaacgcg caa        uc gcccg c c
        -                 u   uagaggug  -     u a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172641.1: 1497321-1497405 [-]
intergenic

Mature sequence xtr-let-7i

Accession MIMAT0003647
Sequence

6 - 

ugagguaguaguuugugcugu

 - 26

Get sequence
Evidence by similarity; MI0000138
Predicted targets