Stem-loop sequence xtr-let-7i

AccessionMI0004889 (change log)
DescriptionXenopus tropicalis let-7i stem-loop
Gene family MIPF0000002; let-7
Stem-loop
        u                 u   --------  u     u u 
5' cuggc gagguaguaguuugugc guu        gg cgggu g g
   ||||| ||||||||||||||||| |||        || ||||| | a
3' gaucg uuccgucaucgaacgcg caa        uc gcccg c c
        -                 u   uagaggug  -     u a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 42598461-42598545 [-]
intergenic
Database links

Mature sequence xtr-let-7i

Accession MIMAT0003647
Sequence

6 - 

ugagguaguaguuugugcugu

 - 26

Get sequence
Evidence by similarity; MI0000138
Predicted targets