Stem-loop sequence xtr-mir-9-3

AccessionMI0004891
DescriptionXenopus tropicalis miR-9-3 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   --       uc               g     gu  aa 
5'   guuucua  uuugguuaucuagcu uauga  gu  a
     |||||||  ||||||||||||||| |||||  ||   
3'   uaaggau  aagccaauagaucga auacu  cg  u
   ac       ga               a     gc  aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172658.1: 2029497-2029572 [-]
intergenic

Mature sequence xtr-miR-9-5p

Accession MIMAT0003649
Previous IDsxtr-miR-9
Sequence

8 - 

ucuuugguuaucuagcuguaug

 - 29

Get sequence
Evidence by similarity; MI0000721
Validated targets
Predicted targets

Mature sequence xtr-miR-9-3p

Accession MIMAT0003650
Previous IDsxtr-miR-9*
Sequence

48 - 

uaaagcuagauaaccgaaagu

 - 68

Get sequence
Evidence by similarity; MI0000721