Stem-loop sequence xtr-mir-9-3

AccessionMI0004891 (change log)
DescriptionXenopus tropicalis miR-9-3 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention xtr-mir-9-3
(1 sentences)

Stem-loop
   --       uc               g     gu  aa 
5'   guuucua  uuugguuaucuagcu uauga  gu  a
     |||||||  ||||||||||||||| |||||  ||   
3'   uaaggau  aagccaauagaucga auacu  cg  u
   ac       ga               a     gc  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 99283850-99283925 [+]
intergenic
Database links

Mature sequence xtr-miR-9-5p

Accession MIMAT0003649
Previous IDsxtr-miR-9
Sequence

8 - 

ucuuugguuaucuagcuguaug

 - 29

Get sequence
Evidence by similarity; MI0000721
Predicted targets

Mature sequence xtr-miR-9-3p

Accession MIMAT0003650
Previous IDsxtr-miR-9*
Sequence

48 - 

uaaagcuagauaaccgaaagu

 - 68

Get sequence
Evidence by similarity; MI0000721
Predicted targets