Stem-loop sequence xtr-mir-18a

AccessionMI0004893 (change log)
DescriptionXenopus tropicalis miR-18a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   gu         -  -u    u   uc   u    a   -  aa u 
5'   gcuuuuugu cc  aagg gca  uag gcag uag ug  g a
     ||||||||| ||  |||| |||  ||| |||| ||| ||  | g
3'   ugaaaaaua gg  uucc cgu  auc cguc auc ac  u a
   --         c  uc    u   ga   c    -   u  ga u 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 120020254-120020340 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-18a
xtr-mir-17chr2: 120020382-120020468 [-]
xtr-mir-18achr2: 120020254-120020340 [-]
xtr-mir-19achr2: 120020112-120020192 [-]
xtr-mir-20achr2: 120019984-120020067 [-]
xtr-mir-19b-2chr2: 120019859-120019937 [-]
xtr-mir-92a-1chr2: 120019740-120019817 [-]
Database links

Mature sequence xtr-miR-18a-5p

Accession MIMAT0003652
Previous IDsxtr-miR-18a
Sequence

14 - 

uaaggugcaucuagugcagauag

 - 36

Get sequence
Evidence by similarity; MI0000567
Predicted targets

Mature sequence xtr-miR-18a-3p

Accession MIMAT0005462
Previous IDsxtr-miR-18a*
Sequence

55 - 

acugcccuaagugcuccuucu

 - 75

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1