Stem-loop sequence xtr-mir-23a-1

AccessionMI0004894
DescriptionXenopus tropicalis miR-23a-1 stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   cu     cg  gg        ag   g     uauu      
5'   gacag  gg  auuccugg  aug gauuu    uuggc 
     |||||  ||  ||||||||  ||| |||||    |||| a
3'   cuguc  cc  uagggacc  uac cuaaa    aaccg 
   --     aa  uu        gu   a     ---u      
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173333.1: 484179-484256 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-23a-1
xtr-mir-23a-1GL173333.1: 484179-484256 [-]
xtr-mir-27aGL173333.1: 483573-483648 [-]
xtr-mir-24bGL173333.1: 483445-483512 [-]

Mature sequence xtr-miR-23a

Accession MIMAT0003568
Sequence

51 - 

aucacauugccagggauuucc

 - 71

Get sequence
Evidence by similarity; MI0000571
Predicted targets