Stem-loop sequence xtr-mir-23a-1

AccessionMI0004894 (change log)
DescriptionXenopus tropicalis miR-23a-1 stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   cu     cg  gg        ag   g     uauu      
5'   gacag  gg  auuccugg  aug gauuu    uuggc 
     |||||  ||  ||||||||  ||| |||||    |||| a
3'   cuguc  cc  uagggacc  uac cuaaa    aaccg 
   --     aa  uu        gu   a     ---u      
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 129998670-129998747 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-23a-1
xtr-mir-23a-1chr3: 129998670-129998747 [+]
xtr-mir-27achr3: 129999278-129999353 [+]
xtr-mir-24bchr3: 129999414-129999481 [+]
Database links

Mature sequence xtr-miR-23a

Accession MIMAT0003568
Sequence

51 - 

aucacauugccagggauuucc

 - 71

Get sequence
Evidence by similarity; MI0000571
Predicted targets