Stem-loop sequence xtr-mir-24a

AccessionMI0004895
DescriptionXenopus tropicalis miR-24a stem-loop
Gene family MIPF0000041; mir-24
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-24_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-24 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. miR-24 is conserved in various species, and is clustered with miR-23 and miR-27, on human chromosome 9 and 19. Recently, miR-24 has been shown to suppress expression of two crucial cell cycle control genes, E2F2 and Myc in hematopoietic differentiation and also to promote keratinocyte differentiation by repressing actin-cytoskeleton regulators PAK4, Tsk5 and ArhGAP19.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
          g   a         ua     ucuau 
5' cucuugu ccu cugaacuga  ucagu     u
   ||||||| ||| |||||||||  |||||      
3' gaggaca gga gacuugacu  gguca     u
          a   c         -c     cacac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172758.1: 2025091-2025157 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-24a
xtr-mir-23bGL172758.1: 2024250-2024337 [+]
xtr-mir-27bGL172758.1: 2024474-2024569 [+]
xtr-mir-24aGL172758.1: 2025091-2025157 [+]

Mature sequence xtr-miR-24a-5p

Accession MIMAT0003653
Previous IDsxtr-miR-189
Sequence

6 - 

gugccuacugaacugauaucagu

 - 28

Get sequence
Evidence by similarity; MI0000231
Predicted targets

Mature sequence xtr-miR-24a-3p

Accession MIMAT0003654
Previous IDsxtr-miR-24a
Sequence

43 - 

uggcucaguucagcaggaacag

 - 64

Get sequence
Evidence by similarity; MI0000231
Predicted targets