Stem-loop sequence xtr-mir-24a

AccessionMI0004895 (change log)
DescriptionXenopus tropicalis miR-24a stem-loop
Gene family MIPF0000041; mir-24
Stem-loop
          g   a         ua     ucuau 
5' cucuugu ccu cugaacuga  ucagu     u
   ||||||| ||| |||||||||  |||||      
3' gaggaca gga gacuugacu  gguca     u
          a   c         -c     cacac 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 123464315-123464381 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-24a
xtr-mir-23bchr1: 123463474-123463561 [+]
xtr-mir-27bchr1: 123463698-123463793 [+]
xtr-mir-24achr1: 123464315-123464381 [+]
Database links

Mature sequence xtr-miR-24a-5p

Accession MIMAT0003653
Previous IDsxtr-miR-189
Sequence

6 - 

gugccuacugaacugauaucagu

 - 28

Get sequence
Evidence by similarity; MI0000231
Predicted targets

Mature sequence xtr-miR-24a-3p

Accession MIMAT0003654
Previous IDsxtr-miR-24a
Sequence

43 - 

uggcucaguucagcaggaacag

 - 64

Get sequence
Evidence by similarity; MI0000231
Predicted targets