Stem-loop sequence xtr-mir-24b

AccessionMI0004896
DescriptionXenopus tropicalis miR-24b stem-loop
Gene family MIPF0000041; mir-24
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-24_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-24 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. miR-24 is conserved in various species, and is clustered with miR-23 and miR-27, on human chromosome 9 and 19. Recently, miR-24 has been shown to suppress expression of two crucial cell cycle control genes, E2F2 and Myc in hematopoietic differentiation and also to promote keratinocyte differentiation by repressing actin-cytoskeleton regulators PAK4, Tsk5 and ArhGAP19.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       c  a   a         uaa    u  uua 
5' cucc gu ccu cugggcuga   ucag gg   u
   |||| || ||| |||||||||   |||| ||   a
3' gagg ca gga gacuugacu   gguc cc   u
       a  -   c         --c    c  uuc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173333.1: 483445-483512 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-24b
xtr-mir-23a-1GL173333.1: 484179-484256 [-]
xtr-mir-27aGL173333.1: 483573-483648 [-]
xtr-mir-24bGL173333.1: 483445-483512 [-]

Mature sequence xtr-miR-24b

Accession MIMAT0003655
Sequence

45 - 

uggcucaguucagcaggacag

 - 65

Get sequence
Evidence by similarity; MI0000231
Predicted targets