Stem-loop sequence xtr-mir-29a

AccessionMI0004897 (change log)
DescriptionXenopus tropicalis miR-29a stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -     u   aagg            uuc       c    ucu 
5'  acccu uua    augacugauuuc   ugguguu agag   u
    ||||| |||    ||||||||||||   ||||||| ||||   u
3'  ugggg agu    uauuggcuaaag   accacga ucuu   u
   a     u   --aa            uuu       -    uug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 75124877-75124963 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-29a
xtr-mir-29dchr3: 75127544-75127618 [-]
xtr-mir-29achr3: 75124877-75124963 [-]
Database links

Mature sequence xtr-miR-29a

Accession MIMAT0003656
Sequence

53 - 

uagcaccauuugaaaucgguu

 - 73

Get sequence
Evidence by similarity; MI0000576
Predicted targets