Stem-loop sequence xtr-mir-30d

AccessionMI0004898
DescriptionXenopus tropicalis miR-30d stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      uu  c  u         ccc           ---   ag 
5' agu  gu gc guaaacauc   gacuggaagcu   gug  g
   |||  || || |||||||||   |||||||||||   |||   
3' ucg  ca cg cguuugugg   cugacuuucga   uac  c
      gc  u  u         --u           guu   gu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172657.1: 3199783-3199863 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-30d
xtr-mir-30dGL172657.1: 3199783-3199863 [-]
xtr-mir-30bGL172657.1: 3195539-3195618 [-]

Mature sequence xtr-miR-30d

Accession MIMAT0003657
Sequence

11 - 

uguaaacauccccgacuggaag

 - 32

Get sequence
Evidence by similarity; MI0000549
Predicted targets