Stem-loop sequence xtr-mir-93a

AccessionMI0004900 (change log)
DescriptionXenopus tropicalis miR-93a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   au      -ca                 g   c  aa 
5'   gggcuu   aagugcuguucgugcag uag uu  u
     ||||||   ||||||||||||||||| ||| ||  a
3'   cccgaa   uucacggcggguacguc auc ag  a
   --      ccc                 -   c  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
KV460378.1: 107132-107204 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-93a
xtr-mir-93aKV460378.1: 107132-107204 [-]
xtr-mir-25-1KV460378.1: 106999-107080 [-]
Database links

Mature sequence xtr-miR-93a

Accession MIMAT0003659
Sequence

10 - 

aaagugcuguucgugcagguag

 - 31

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1