Stem-loop sequence xtr-mir-93b

AccessionMI0004901 (change log)
DescriptionXenopus tropicalis miR-93b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   --cuuc                 g   c  aa 
5'       aagugcuguucgugcag uag uu  u
         ||||||||||||||||| ||| ||  a
3'       uucacggcggguacguc auc ag  a
   gaaccc                 -   c  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence xtr-miR-93b

Accession MIMAT0003660
Sequence

5 - 

aagugcuguucgugcagguag

 - 25

Get sequence
Evidence by similarity; MI0000581
Predicted targets

References

1