Stem-loop sequence xtr-mir-96

AccessionMI0004902 (change log)
DescriptionXenopus tropicalis miR-96 stem-loop
Gene family MIPF0000072; mir-96
Stem-loop
   gg    cu         g     uu      -uu   c 
5'   ccug  uuggcacua cacau  uugcuu   gua a
     ||||  ||||||||| |||||  ||||||   |||  
3'   ggau  aaccgugau gugua  aacgag   cau u
   -a    au         -     uu      uuu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 77400813-77400887 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-96
xtr-mir-183chr3: 77399646-77399742 [+]
xtr-mir-96chr3: 77400813-77400887 [+]
xtr-mir-182chr3: 77404446-77404550 [+]
Database links

Mature sequence xtr-miR-96

Accession MIMAT0003661
Sequence

8 - 

uuuggcacuagcacauuuuugcu

 - 30

Get sequence
Evidence by similarity; MI0001955
Predicted targets