Stem-loop sequence xtr-mir-101a-2

AccessionMI0004903 (change log)
DescriptionXenopus tropicalis miR-101a-2 stem-loop
Gene family MIPF0000046; mir-101
Stem-loop
   a       cuggc                  a    gucua 
5'  ggcugcc     ucaguuaucacagugcug ugcu     c
    |||||||     |||||||||||||||||| ||||      
3'  ccgaugg     agucaauagugucaugac augg     u
   a       uagga                  -    aaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr4: 79102552-79102634 [-]
intergenic
Database links

Mature sequence xtr-miR-101a

Accession MIMAT0003662
Sequence

51 - 

uacaguacugugauaacugaag

 - 72

Get sequence
Evidence by similarity; MI0000648
Predicted targets