Stem-loop sequence xtr-mir-103-1

AccessionMI0004904 (change log)
DescriptionXenopus tropicalis miR-103-1 stem-loop
Gene family MIPF0000024; mir-103
Stem-loop
   u     uu      --    u  u           c   u g a 
5'  ucuca  uccuuu  ggcu cu uacagugcugc uug u c u
    |||||  ||||||  |||| || ||||||||||| ||| | |  
3'  agagu  aggaag  ucgg ga auguuacgacg aac a g a
   -     cu      ua    -  c           -   u g u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 24141492-24141576 [+]
sense
ENSXETT00000029925 ; pank3-201; intron 5
Database links

Mature sequence xtr-miR-103

Accession MIMAT0003663
Sequence

52 - 

agcagcauuguacagggcuauga

 - 74

Get sequence
Evidence by similarity; MI0000588
Predicted targets