Stem-loop sequence xtr-mir-148a

AccessionMI0004905 (change log)
DescriptionXenopus tropicalis miR-148a stem-loop
Gene family MIPF0000056; mir-148
Stem-loop
      u        u            --a    ua    -   aa 
5' uag cuuuuaaa caaaguucugug   cacu  gacu cug  u
   ||| |||||||| ||||||||||||   ||||  |||| |||  a
3' guc gaggguuu guuucaagacau   guga  cuga gau  u
      u        u            cac    --    c   ag 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr6: 33524404-33524489 [+]
intergenic
Database links

Mature sequence xtr-miR-148a

Accession MIMAT0003664
Sequence

53 - 

ucagugcacuacagaacuuugu

 - 74

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1