Stem-loop sequence xtr-mir-338-1

AccessionMI0004906 (change log)
DescriptionXenopus tropicalis miR-338-1 stem-loop
Gene family MIPF0000097; mir-338
Stem-loop
   -   c    g     u   -         aau     - ga 
5'  guc ccug aacaa auc cugaugcug   gagug g  c
    ||| |||| ||||| ||| |||||||||   ||||| |   
3'  cgg ggac uuguu uag gacuacgac   cucgu c  a
   a   c    g     u   u         ---     a au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr10: 18675785-18675862 [+]
sense
ENSXETT00000029386 ; aatk-201; intron 7
Database links

Mature sequence xtr-miR-338

Accession MIMAT0003665
Sequence

48 - 

uccagcaucagugauuuuguug

 - 69

Get sequence
Evidence by similarity; MI0002066
Predicted targets