Stem-loop sequence xtr-mir-338-1

AccessionMI0004906
DescriptionXenopus tropicalis miR-338-1 stem-loop
Gene family MIPF0000097; mir-338
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-338. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-338 is a family of brain-specific microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-338 is located in an intronic region within the gene for apoptosis-associated tyrosine kinase (AATK). It has been predicted that it may downregulate genes which have a downstream negative effect on AATK expression.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -   c    g     u   -         aau     - ga 
5'  guc ccug aacaa auc cugaugcug   gagug g  c
    ||| |||| ||||| ||| |||||||||   ||||| |   
3'  cgg ggac uuguu uag gacuacgac   cucgu c  a
   a   c    g     u   u         ---     a au 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172918.1: 153858-153935 [+]
sense
ENSXETT00000029386 ; aatk-201; intron 7

Mature sequence xtr-miR-338

Accession MIMAT0003665
Sequence

48 - 

uccagcaucagugauuuuguug

 - 69

Get sequence
Evidence by similarity; MI0002066
Predicted targets