Stem-loop sequence xtr-let-7e-1

AccessionMI0004907 (change log)
DescriptionXenopus tropicalis let-7e-1 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   cc  g     u   gu          u     auugggccgcac 
5'   cu uggga gag  aguagguugu uaguu            c
     || ||||| |||  |||||||||| |||||            c
3'   ga auccu cuc  ucauccaaca aucaa            a
   gu  a     -   ug          c     gagaggguaacc 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence xtr-let-7e

Accession MIMAT0003666
Sequence

11 - 

ugagguaguagguuguuuaguu

 - 32

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1