Stem-loop sequence xtr-let-7a

AccessionMI0004908 (change log)
DescriptionXenopus tropicalis let-7a stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   gu          cu       u              aggauaac 
5'   gggcuccagg  gagguag agguuguauaguug        a
     ||||||||||  ||||||| ||||||||||||||        c
3'   uucggggucc  uucuauc uccgacaugucaau        c
   --          cu       c              agaggaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr7: 112714565-112714653 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-let-7a
xtr-mir-100chr7: 112711713-112711788 [+]
xtr-let-7achr7: 112714565-112714653 [+]
Database links

Mature sequence xtr-let-7a

Accession MIMAT0003667
Sequence

14 - 

ugagguaguagguuguauaguu

 - 35

Get sequence
Evidence by similarity; MI0000828
Predicted targets