Stem-loop sequence xtr-let-7e-2

AccessionMI0004909 (change log)
DescriptionXenopus tropicalis let-7e-2 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --   -   ug   u   gu          u       ----------   u 
5'   gcc cuu  ggg gag  aguagguugu uaguugu          ggg u
     ||| |||  ||| |||  |||||||||| |||||||          ||| g
3'   cgg gaa  ccu uuc  ucaucuaaca aucaaua          ccc c
   gu   u   gu   -   ug          u       gguuugcagu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence xtr-let-7e

Accession MIMAT0003666
Sequence

12 - 

ugagguaguagguuguuuaguu

 - 33

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1