Stem-loop sequence xtr-mir-16b

AccessionMI0004910 (change log)
DescriptionXenopus tropicalis miR-16b stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   aa    uc   auu     c   ua         u --a     
5'   uugc  cgc   agcag acg  aauauuggg g   uaug 
     ||||  |||   ||||| |||  ||||||||| |   ||| a
3'   aacg  gug   ucguc ugu  uuaugaccc c   guau 
   gg    gu   aau     a   ua         - gag     
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr5: 103362038-103362121 [-]
sense
ENSXETT00000019103 ; smc4-201; intron 5
Clustered miRNAs
< 10kb from xtr-mir-16b
xtr-mir-15bchr5: 103362195-103362282 [-]
xtr-mir-16bchr5: 103362038-103362121 [-]
Database links

Mature sequence xtr-miR-16b

Accession MIMAT0003668
Sequence

14 - 

uagcagcacguaaauauugggu

 - 35

Get sequence
Evidence by similarity; MI0000844
Predicted targets