Stem-loop sequence xtr-mir-20a

AccessionMI0004911 (change log)
DescriptionXenopus tropicalis miR-20a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   --   aa  ug     -a          a      g   uu uu 
5'   gcu  ag  gugcu  aagugcuuau gugcag uag  u  c
     |||  ||  |||||  |||||||||| |||||| |||  |   
3'   cga  uc  cauga  uucacgagua uacguc auc  a  u
   gu   --  cu     aa          a      -   uu ug 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 120019984-120020067 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-20a
xtr-mir-17chr2: 120020382-120020468 [-]
xtr-mir-18achr2: 120020254-120020340 [-]
xtr-mir-19achr2: 120020112-120020192 [-]
xtr-mir-20achr2: 120019984-120020067 [-]
xtr-mir-19b-2chr2: 120019859-120019937 [-]
xtr-mir-92a-1chr2: 120019740-120019817 [-]
Database links

Mature sequence xtr-miR-20a-5p

Accession MIMAT0003669
Previous IDsxtr-miR-20a
Sequence

14 - 

uaaagugcuuauagugcagguag

 - 36

Get sequence
Evidence by similarity; MI0001907
Predicted targets

Mature sequence xtr-miR-20a-3p

Accession MIMAT0003670
Previous IDsxtr-miR-20a*
Sequence

51 - 

acugcauaaugagcacuuaaa

 - 71

Get sequence
Evidence by similarity; MI0001907
Predicted targets