Stem-loop sequence xtr-mir-22

AccessionMI0004912
DescriptionXenopus tropicalis miR-22 stem-loop
Gene family MIPF0000053; mir-22
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-22. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-22 microRNA is a short RNA molecule. MicroRNAs are an abundant class of molecules, approximately 22 nucleotides in length, which can post-transcriptionally regulate gene expression by binding to the 3’ UTR of mRNAs expressed in a cell.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -c     c   aga             -     a      u  uguu 
5'   uggcc gcu   agcaguucuucag uggca gcuuua gu    c
     ||||| |||   ||||||||||||| ||||| |||||| ||    c
3'   aucgg uga   uugucaagaaguu accgu cgaaau cg    u
   uc     -   aag             g     -      -  uguc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172820.1: 1524287-1524378 [-]
intergenic

Mature sequence xtr-miR-22-5p

Accession MIMAT0003671
Previous IDsxtr-miR-22*
Sequence

17 - 

aguucuucaguggcaagcuuu

 - 37

Get sequence
Evidence by similarity; MI0000570

Mature sequence xtr-miR-22-3p

Accession MIMAT0003672
Previous IDsxtr-miR-22
Sequence

57 - 

aagcugccaguugaagaacugu

 - 78

Get sequence
Evidence by similarity; MI0000570
Predicted targets