Stem-loop sequence xtr-mir-23b

AccessionMI0004913
DescriptionXenopus tropicalis miR-23b stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   cc  ug   c   u   --          -  c      gug   u 
5'   gg  ugg ugu ugg  guuccuggca ug ugauuu   agu a
     ||  ||| ||| |||  |||||||||| || ||||||   |||  
3'   cu  acc aca acc  uagggaccgu ac acuaaa   uua a
   uc  gu   a   c   au          u  -      --a   g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172758.1: 2024250-2024337 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-23b
xtr-mir-23bGL172758.1: 2024250-2024337 [+]
xtr-mir-27bGL172758.1: 2024474-2024569 [+]
xtr-mir-24aGL172758.1: 2025091-2025157 [+]

Mature sequence xtr-miR-23b

Accession MIMAT0003673
Sequence

53 - 

aucacauugccagggauuacc

 - 73

Get sequence
Evidence by similarity; MI0000853
Predicted targets