Stem-loop sequence xtr-mir-25-1

AccessionMI0004914
DescriptionXenopus tropicalis miR-25-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
        ug   a     a        a    c     g  u 
5' gcugg  uug caggc gagacagg gcaa ugcug ug g
   |||||  ||| ||||| |||||||| |||| ||||| || c
3' cggcu  gac gucug cucuguuc cguu acgau gu c
        gu   a     g        a    -     g  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173561.1: 279004-279085 [-]
sense
ENSXETT00000019971 ; mcm7-201; exon 12
Clustered miRNAs
< 10kb from xtr-mir-25-1
xtr-mir-93bGL173561.1: 279140-279203 [-]
xtr-mir-25-1GL173561.1: 279004-279085 [-]

Mature sequence xtr-miR-25

Accession MIMAT0003674
Sequence

51 - 

cauugcacuugucucggucuga

 - 72

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1