Stem-loop sequence xtr-mir-25-2

AccessionMI0004915
DescriptionXenopus tropicalis miR-25-2 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
        ug   a     a        a    c     g  u 
5' gcugg  uug caggc gagacagg gcaa ugcug ug g
   |||||  ||| ||||| |||||||| |||| ||||| || c
3' cggcu  gac gucug cucuguuc cguu acgau gu c
        gu   a     g        a    -     g  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL177890.1: 6924-7005 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-25-2
xtr-mir-93aGL177890.1: 6800-6872 [+]
xtr-mir-25-2GL177890.1: 6924-7005 [+]

Mature sequence xtr-miR-25

Accession MIMAT0003674
Sequence

51 - 

cauugcacuugucucggucuga

 - 72

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1