Stem-loop sequence xtr-mir-27c-2

AccessionMI0004917
DescriptionXenopus tropicalis miR-27c-2 stem-loop
Gene family MIPF0000036; mir-27
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-27. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA mir-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of mir-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and mir-24 in a co-operative cluster.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cu    a a  ca          ggcu         -ggu uu 
5'   cuag g gg  ggacuuagcu    cugugaaca    c  g
     |||| | ||  ||||||||||    |||||||||    |   
3'   gguc c cc  cuugaaucgg    gacacuugu    g  u
   --    a c  ac          ---u         aacu ug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172640.1: 587849-587930 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-27c-2
xtr-mir-23a-2GL172640.1: 579916-579998 [+]
xtr-mir-27c-1GL172640.1: 580205-580286 [+]
xtr-mir-27c-2GL172640.1: 587849-587930 [+]

Mature sequence xtr-miR-27c

Accession MIMAT0003675
Sequence

54 - 

uucacaguggcuaaguuccac

 - 74

Get sequence
Evidence by similarity; MI0001928
Predicted targets