Stem-loop sequence xtr-mir-27c-2

AccessionMI0004917 (change log)
DescriptionXenopus tropicalis miR-27c-2 stem-loop
Gene family MIPF0000036; mir-27
Stem-loop
   cu    a a  ca          ggcu         -ggu uu 
5'   cuag g gg  ggacuuagcu    cugugaaca    c  g
     |||| | ||  ||||||||||    |||||||||    |   
3'   gguc c cc  cuugaaucgg    gacacuugu    g  u
   --    a c  ac          ---u         aacu ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence xtr-miR-27c

Accession MIMAT0003675
Sequence

54 - 

uucacaguggcuaaguuccac

 - 74

Get sequence
Evidence by similarity; MI0001928
Predicted targets