Stem-loop sequence xtr-mir-29c

AccessionMI0004918
DescriptionXenopus tropicalis miR-29c stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     -       cagg         c  ucu       ---ca     u 
5' uc ccuuaca    augaccgau uc   ugguguu     gaggc c
   || |||||||    ||||||||| ||   |||||||     |||||  
3' ag ggaaugu    uauuggcua ag   accacga     uucug a
     u       --aa         a  uuu       ucuac     g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173009.1: 252928-253017 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-29c
xtr-mir-29bGL173009.1: 249795-249874 [+]
xtr-mir-29cGL173009.1: 252928-253017 [+]

Mature sequence xtr-miR-29c-5p

Accession MIMAT0003676
Previous IDsxtr-miR-29c*
Sequence

15 - 

ugaccgaucucucuugguguuc

 - 36

Get sequence
Evidence by similarity; MI0000735

Mature sequence xtr-miR-29c-3p

Accession MIMAT0003677
Previous IDsxtr-miR-29c
Sequence

56 - 

uagcaccauuugaaaucggu

 - 75

Get sequence
Evidence by similarity; MI0000735
Predicted targets