Stem-loop sequence xtr-mir-30c-2

AccessionMI0004919 (change log)
DescriptionXenopus tropicalis miR-30c-2 stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   --      cagauacu       u   aca         g  ga 
5'   gagaga        guaaaca ccu   cucucagcu ug  a
     ||||||        ||||||| |||   ||||||||| ||   
3'   cucucu        cauuugu gga   gggggucga ac  a
   gu      --------       c   --a         a  au 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr5: 91680390-91680467 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-30c-2
xtr-mir-30achr5: 91687780-91687850 [-]
xtr-mir-30c-2chr5: 91680390-91680467 [-]
Database links

Mature sequence xtr-miR-30c

Accession MIMAT0003577
Sequence

14 - 

uguaaacauccuacacucucagc

 - 36

Get sequence
Evidence by similarity; MI0000871
Predicted targets