Stem-loop sequence xtr-mir-31a

AccessionMI0004921
Previous IDsxtr-mir-31
DescriptionXenopus tropicalis miR-31 stem-loop
Gene family MIPF0000064; mir-31
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-31. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-31 has been characterised as a tumour suppressor miRNA, with its levels varying in breast cancer cells according to the metastatic state of the tumour. From its typical abundance in healthy tissue is a moderate decrease in non-metastatic breast cancer cell lines, and levels are almost completely absent in mouse and human metastatic breast cancer cell lines. There has also been observed a strong encapsulation of tumour cells expressing miR-31, as well as a reduced cell survival rate. miR-31's antimetastatic effects therefore make it a potential therapeutic target for breast cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cc   uucu      ga     gau             -  gca 
5'   uag    agagag  ggcaa   guuggcauagcug uu   u
     |||    ||||||  |||||   ||||||||||||| ||    
3'   auc    ucuuuc  ccguu   caaccguguugac aa   c
   cc   -ugu      ua     auc             c  agu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172714.1: 1969458-1969545 [+]
intergenic

Mature sequence xtr-miR-31a

Accession MIMAT0003679
Previous IDsxtr-miR-31
Sequence

17 - 

aggcaagauguuggcauagcug

 - 38

Get sequence
Evidence by similarity; MI0000579
Predicted targets