Stem-loop sequence xtr-mir-31a

AccessionMI0004921 (change log)
Previous IDsxtr-mir-31
DescriptionXenopus tropicalis miR-31 stem-loop
Gene family MIPF0000064; mir-31
Literature search

1 open access papers mention xtr-mir-31a
(1 sentences)

Stem-loop
   cc   uucu      ga     gau             -  gca 
5'   uag    agagag  ggcaa   guuggcauagcug uu   u
     |||    ||||||  |||||   ||||||||||||| ||    
3'   auc    ucuuuc  ccguu   caaccguguugac aa   c
   cc   -ugu      ua     auc             c  agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 108909677-108909764 [-]
intergenic
Database links

Mature sequence xtr-miR-31a

Accession MIMAT0003679
Previous IDsxtr-miR-31
Sequence

17 - 

aggcaagauguuggcauagcug

 - 38

Get sequence
Evidence by similarity; MI0000579
Predicted targets