Stem-loop sequence xtr-mir-34b-1

AccessionMI0004925 (change log)
DescriptionXenopus tropicalis miR-34b-1 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   u   g      - a  c   g       c       --   aa 
5'  guu gguuuu c gg agu uaguuag ugauugu  guu  c
    ||| |||||| | || ||| ||||||| |||||||  |||  a
3'  caa ucaaaa g cc uca aucgauc acuaacg  cag  u
   a   a      c a  a   a       -       uu   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr7: 75066349-75066433 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-34b-1
xtr-mir-34b-2chr7: 75059637-75059703 [-]
xtr-mir-34b-1chr7: 75066349-75066433 [+]
Database links

Mature sequence xtr-miR-34b

Accession MIMAT0003579
Sequence

12 - 

caggcaguguaguuagcugauug

 - 34

Get sequence
Evidence by similarity; MI0003690
Predicted targets