Stem-loop sequence xtr-mir-34b-1

AccessionMI0004925
DescriptionXenopus tropicalis miR-34b-1 stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u   g      - a  c   g       c       --   aa 
5'  guu gguuuu c gg agu uaguuag ugauugu  guu  c
    ||| |||||| | || ||| ||||||| |||||||  |||  a
3'  caa ucaaaa g cc uca aucgauc acuaacg  cag  u
   a   a      c a  a   a       -       uu   aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172675.1: 3202240-3202324 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-34b-1
xtr-mir-34b-2GL172675.1: 3208149-3208215 [+]
xtr-mir-34b-1GL172675.1: 3202240-3202324 [-]

Mature sequence xtr-miR-34b

Accession MIMAT0003579
Sequence

12 - 

caggcaguguaguuagcugauug

 - 34

Get sequence
Evidence by similarity; MI0003690
Predicted targets