Stem-loop sequence xtr-mir-92a-1

AccessionMI0004926 (change log)
DescriptionXenopus tropicalis miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   cu     u            u   u           cu 
5'   uucug auagguugggau ggu gcaaugcugua  a
     ||||| |||||||||||| ||| |||||||||||  u
3'   aggau uguccggcccug uca cguuaugaugu  u
   gu     u            u   -           au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 120019740-120019817 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-92a-1
xtr-mir-17chr2: 120020382-120020468 [-]
xtr-mir-18achr2: 120020254-120020340 [-]
xtr-mir-19achr2: 120020112-120020192 [-]
xtr-mir-20achr2: 120019984-120020067 [-]
xtr-mir-19b-2chr2: 120019859-120019937 [-]
xtr-mir-92a-1chr2: 120019740-120019817 [-]
Database links

Mature sequence xtr-miR-92a

Accession MIMAT0003580
Sequence

49 - 

uauugcacuugucccggccug

 - 69

Get sequence
Evidence by similarity; MI0001951
Predicted targets