Stem-loop sequence xtr-mir-100

AccessionMI0004927
DescriptionXenopus tropicalis miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   --    c    a       g uc   a      cu ug 
5'   guug caua acccgua a  cga cuugug  g  c
     |||| |||| ||||||| |  ||| ||||||  |  c
3'   cggc gugu ugggcgu u  gcu gaacac  c  c
   uu    u    c       g ga   c      -u uc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172961.1: 946793-946868 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-100
xtr-mir-100GL172961.1: 946793-946868 [+]
xtr-let-7aGL172961.1: 948723-948811 [+]

Mature sequence xtr-miR-100

Accession MIMAT0003682
Sequence

10 - 

aacccguagauccgaacuugug

 - 31

Get sequence
Evidence by similarity; MI0000885
Predicted targets