Stem-loop sequence xtr-mir-101a-1

AccessionMI0004928 (change log)
DescriptionXenopus tropicalis miR-101a-1 stem-loop
Gene family MIPF0000046; mir-101
Stem-loop
   gc   -a  ug  c                    cg     gugua 
5'   gug  ac  uc uuuuucgguuaucaugguac  gugcu     u
     |||  ||  || ||||||||||||||||||||  |||||      
3'   uac  ug  gg aagaagucaauagugucaug  caugg     a
   -c   cg  gu  u                    -a     aaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 115031336-115031426 [-]
sense
ENSXETT00000001308 ; rcl1-201; intron 7
Database links

Mature sequence xtr-miR-101a

Accession MIMAT0003662
Sequence

55 - 

uacaguacugugauaacugaag

 - 76

Get sequence
Evidence by similarity; MI0000648
Predicted targets