Stem-loop sequence xtr-mir-101a-1

AccessionMI0004928 (change log)
DescriptionXenopus tropicalis miR-101a-1 stem-loop
Gene family MIPF0000046; mir-101
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-101_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-101 microRNA precursor is a small non-coding RNA that regulates gene expression. Expression of miR-101 has been validated in both human (MI0000103, MI0000739) and mouse (MI0000148). This microRNA appears to be specific to the vertebrates and has now been predicted or confirmed in a wide range of vertebrate species (MIPF0000046). The precursor microRNA is a stem-loop structure of about 70 nucleotides in length that is processed by the Dicer enzyme to form the 21-24 nucleotide mature microRNA. In this case the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
   gc   -a  ug  c                    cg     gugua 
5'   gug  ac  uc uuuuucgguuaucaugguac  gugcu     u
     |||  ||  || ||||||||||||||||||||  |||||      
3'   uac  ug  gg aagaagucaauagugucaug  caugg     a
   -c   cg  gu  u                    -a     aaagu 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 115031336-115031426 [-]
ENSXETT00000001308 ; rcl1-201; intron 7
Database links

Mature sequence xtr-miR-101a

Accession MIMAT0003662

55 - 


 - 76

Get sequence
Evidence by similarity; MI0000648
Predicted targets