Stem-loop sequence xtr-mir-103-2

AccessionMI0004929
DescriptionXenopus tropicalis miR-103-2 stem-loop
Gene family MIPF0000024; mir-103
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -      g      --   u  u           c   ua   u 
5'  cucugu cuuuca  gcu cu uacagugcugc uug  gca c
    |||||| ||||||  ||| || ||||||||||| |||  |||  
3'  gagacg ggaagu  cgg ga auguuacgacg aac  ugu u
   a      a      au   -  c           -   --   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172841.1: 1688027-1688109 [+]
sense
ENSXETT00000038997 ; pank2-201; intron 4

Mature sequence xtr-miR-103

Accession MIMAT0003663
Sequence

50 - 

agcagcauuguacagggcuauga

 - 72

Get sequence
Evidence by similarity; MI0000588
Predicted targets