Stem-loop sequence xtr-mir-103-2

AccessionMI0004929 (change log)
DescriptionXenopus tropicalis miR-103-2 stem-loop
Gene family MIPF0000024; mir-103
Stem-loop
   -      g      --   u  u           c   ua   u 
5'  cucugu cuuuca  gcu cu uacagugcugc uug  gca c
    |||||| ||||||  ||| || ||||||||||| |||  |||  
3'  gagacg ggaagu  cgg ga auguuacgacg aac  ugu u
   a      a      au   -  c           -   --   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 6083393-6083475 [+]
sense
ENSXETT00000038997 ; pank2-201; intron 4
Database links

Mature sequence xtr-miR-103

Accession MIMAT0003663
Sequence

50 - 

agcagcauuguacagggcuauga

 - 72

Get sequence
Evidence by similarity; MI0000588
Predicted targets