Stem-loop sequence xtr-mir-124

AccessionMI0004930 (change log)
DescriptionXenopus tropicalis miR-124 stem-loop
Gene family MIPF0000021; mir-124
Literature search

1 open access papers mention xtr-mir-124
(1 sentences)

Stem-loop
   ua  u    g     cc        a   ga        uaau 
5'   ag cucu acucu  guguucac gcg  ccuugauu    g
     || |||| |||||  |||||||| |||  ||||||||    u
3'   uc gagg ugaga  cguaagug cgc  ggaauuaa    c
   ca  c    -     ac        g   ac        caua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr6: 103250597-103250684 [+]
intergenic
Database links

Mature sequence xtr-miR-124

Accession MIMAT0003683
Sequence

53 - 

uuaaggcacgcggugaaugcca

 - 74

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1