Stem-loop sequence xtr-mir-124

AccessionMI0004930
DescriptionXenopus tropicalis miR-124 stem-loop
Gene family MIPF0000021; mir-124
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation. However these results are controversial since other reports have described a role for miR-124 during neuronal differentiation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ua  u    g     cc        a   ga        uaau 
5'   ag cucu acucu  guguucac gcg  ccuugauu    g
     || |||| |||||  |||||||| |||  ||||||||    u
3'   uc gagg ugaga  cguaagug cgc  ggaauuaa    c
   ca  c    -     ac        g   ac        caua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172825.1: 1874513-1874600 [+]
intergenic

Mature sequence xtr-miR-124

Accession MIMAT0003683
Sequence

53 - 

uuaaggcacgcggugaaugcca

 - 74

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1