Stem-loop sequence xtr-mir-125a

AccessionMI0004931
DescriptionXenopus tropicalis miR-125a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   --- uc   g   c     a       g aag 
5'    g  ccu aga ccuua ccuguga g   a
      |  ||| ||| ||||| ||||||| |    
3'    c  gga ucu ggagu ggacacu u   c
   ggu ga   g   u     -       g aua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172961.1: 961677-961738 [+]
intergenic

Mature sequence xtr-miR-125a

Accession MIMAT0003684
Sequence

2 - 

ucccugagacccuuaaccugug

 - 23

Get sequence
Evidence by similarity; MI0001972
Predicted targets