Stem-loop sequence xtr-mir-128-1

AccessionMI0004932 (change log)
DescriptionXenopus tropicalis miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   u   c        cc   c    ag      cu      gu 
5'  gag ggcuggaa  ggg ccgg  cgcugu  gagagg  u
    ||| ||||||||  ||| ||||  ||||||  ||||||  u
3'  uuc cugacuuu  cuc ggcc  gugaca  cucuuu  a
   c   u        uu   u    aa      --      ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr9: 78757409-78757491 [-]
sense
ENSXETT00000041886 ; r3hdm1-201; intron 18
Database links

Mature sequence xtr-miR-128

Accession MIMAT0003589
Sequence

51 - 

ucacagugaaccggucucuuuu

 - 72

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1