Stem-loop sequence xtr-mir-135-2

AccessionMI0004933 (change log)
DescriptionXenopus tropicalis miR-135-2 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   -c      c  a               au          uugcu 
5'   ccccug ug gguauauggcuuuuu  uccuauguga     u
     |||||| || |||||||||||||||  ||||||||||     u
3'   ggggac ac ucguguaccgaaaga  gggauacacu     c
   ca      -  g               -c          uaauc 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 64757290-64757377 [-]
intergenic
Database links

Mature sequence xtr-miR-135

Accession MIMAT0003598
Sequence

16 - 

uauggcuuuuuauuccuauguga

 - 38

Get sequence
Evidence by similarity; MI0000645
Predicted targets