Stem-loop sequence xtr-mir-135-2

AccessionMI0004933
DescriptionXenopus tropicalis miR-135-2 stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -c      c  a               au          uugcu 
5'   ccccug ug gguauauggcuuuuu  uccuauguga     u
     |||||| || |||||||||||||||  ||||||||||     u
3'   ggggac ac ucguguaccgaaaga  gggauacacu     c
   ca      -  g               -c          uaauc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172677.1: 3524143-3524230 [-]
intergenic

Mature sequence xtr-miR-135

Accession MIMAT0003598
Sequence

16 - 

uauggcuuuuuauuccuauguga

 - 38

Get sequence
Evidence by similarity; MI0000645
Predicted targets