Stem-loop sequence xtr-mir-137-2

AccessionMI0004935 (change log)
DescriptionXenopus tropicalis miR-137-2 stem-loop
Gene family MIPF0000106; mir-137
Stem-loop
   -   -cugug           ug   g           ug a     -  g 
5'  gcu      gcucucuucgg  acg guauucuuggg  g uaaua cg a
    |||      |||||||||||  ||| |||||||||||  | ||||| || u
3'  cga      ugagaggaguu  ugc cauaagaauuc  u auugu gc u
   a   cuucua           ga   g           gu -     u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence xtr-miR-137

Accession MIMAT0003685
Sequence

59 - 

uauugcuuaagaauacgcguag

 - 80

Get sequence
Evidence by similarity; MI0002000
Predicted targets