Stem-loop sequence xtr-mir-143

AccessionMI0004937 (change log)
DescriptionXenopus tropicalis miR-143 stem-loop
Gene family MIPF0000094; mir-143
Stem-loop
   ug      ag   a  g         g      u  -   g 
5'   ucuccc  ccc ag ugcagugcu caucuc gg uca u
     ||||||  ||| || ||||||||| |||||| || |||  
3'   aggggg  ggg uc augucacga guagag cu agu u
   ua      aa   c  g         a      u  g   g 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 31806258-31806340 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-143
xtr-mir-143chr3: 31806258-31806340 [+]
xtr-mir-145chr3: 31807219-31807304 [+]
Database links

Mature sequence xtr-miR-143

Accession MIMAT0003686
Sequence

50 - 

ugagaugaagcacuguagcucg

 - 71

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1