Stem-loop sequence xtr-mir-143

AccessionMI0004937
DescriptionXenopus tropicalis miR-143 stem-loop
Gene family MIPF0000094; mir-143
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-143. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-143 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by a several mechanisms. mir–143 is highly conserved in vertebrates. mir-143 is thought be involved in cardiac morphogenesis but has also been implicated in cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ug      ag   a  g         g      u  -   g 
5'   ucuccc  ccc ag ugcagugcu caucuc gg uca u
     ||||||  ||| || ||||||||| |||||| || |||  
3'   aggggg  ggg uc augucacga guagag cu agu u
   ua      aa   c  g         a      u  g   g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173083.1: 665585-665667 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-143
xtr-mir-143GL173083.1: 665585-665667 [+]
xtr-mir-145GL173083.1: 666546-666631 [+]

Mature sequence xtr-miR-143

Accession MIMAT0003686
Sequence

50 - 

ugagaugaagcacuguagcucg

 - 71

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1